|
MedCalc Software Ltd
medcalc version 17.4.4 Medcalc Version 17.4.4, supplied by MedCalc Software Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/medcalc+9+0+1/pmc06156314-85-15-14 Average 90 stars, based on 1 article reviews
medcalc version 17.4.4 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
STATA Corporation
graph pad prism1 2007 software Graph Pad Prism1 2007 Software, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/STATA+5%2E0/pm21112824-95-8-15 Average 99 stars, based on 1 article reviews
graph pad prism1 2007 software - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
RStudio
version 3.6.2 Version 3.6.2, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/rstudio+version+1+3+1093/pmc07573152-161-11-9 Average 90 stars, based on 1 article reviews
version 3.6.2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
SYSTAT
tablecurve 2d Tablecurve 2d, supplied by SYSTAT, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/TableCurve+2D+v5%2E0/pmc09105696-220-0-7 Average 95 stars, based on 1 article reviews
tablecurve 2d - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
MedCalc Software Ltd
version 19.6 Version 19.6, supplied by MedCalc Software Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/version+19+1/pmc08447905-72-11-10 Average 90 stars, based on 1 article reviews
version 19.6 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Abbott Laboratories
ld 50 values Ld 50 Values, supplied by Abbott Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/50+ld+values/pmc12441774-83-30-24 Average 86 stars, based on 1 article reviews
ld 50 values - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Chemical Computing Group
d 001810 10 50 software D 001810 10 50 Software, supplied by Chemical Computing Group, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/environment+molecular+operating/pm42085183-230-59-87 Average 86 stars, based on 1 article reviews
d 001810 10 50 software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Becton Dickinson
facs diva 5.1 software Facs Diva 5.1 Software, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/facsdiva+software/pm33440150-234-176-189 Average 90 stars, based on 1 article reviews
facs diva 5.1 software - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
10X Genomics
krec assay reverse 50 ctccaataagtcaccctttccttgt 30 Krec Assay Reverse 50 Ctccaataagtcaccctttccttgt 30, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/30+50+assay+ctccaataagtcaccctttccttgt+krec+reverse/pm34626548-177-176-202 Average 86 stars, based on 1 article reviews
krec assay reverse 50 ctccaataagtcaccctttccttgt 30 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Bio-Rad
tungsten particles bio rad dii invitrogen 11520326 mitoplates s1 biolog 14105 tgx stain free fastcast acrylamide solutions bio rad 1610183 Tungsten Particles Bio Rad Dii Invitrogen 11520326 Mitoplates S1 Biolog 14105 Tgx Stain Free Fastcast Acrylamide Solutions Bio Rad 1610183, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/SFX+ACRYL+SOLN+10%25%2C50-GEL+KIT/pm39333440-216-24-26 Average 96 stars, based on 1 article reviews
tungsten particles bio rad dii invitrogen 11520326 mitoplates s1 biolog 14105 tgx stain free fastcast acrylamide solutions bio rad 1610183 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Greiner Bio
easyseal plate sealer ![]() Easyseal Plate Sealer, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/Tube+50+Ml+Pp+30%2F115+Mm+Conical+Bottom/pmc10877937-5-284-280 Average 96 stars, based on 1 article reviews
easyseal plate sealer - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Physiologic Instruments
vcc mc-2 amplifiers ![]() Vcc Mc 2 Amplifiers, supplied by Physiologic Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/voltage+clamp+amplifier+vcc+mc6/pm34610318-143-78-102 Average 90 stars, based on 1 article reviews
vcc mc-2 amplifiers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: MethodsX
Article Title: An efficient ELISA protocol for measurement of SARS-CoV-2 spike-specific IgG in human plasma and serum samples
doi: 10.1016/j.mex.2024.102596
Figure Lengend Snippet:
Article Snippet: , Self-prepared buffers and solutions Stock solutions of PBSA and PBSA-S should be kept sterile and stored at 4 °C. • 0.1 M sodium hydrogen carbonate (pH 8.6) • 1 N sulfuric acid • PBS with 0.05 % Tween 20 (PBS-T5) • PBS with 5 % BSA (PBSA) • PBSA with 0.01 % Tween 20 (PBSA-T1) • PBSA with 20 % sheep serum (PBSA-S) Assay controls • Positive control: SARS-CoV-2 IgG high serum or plasma sample. If not available, a positive control can be generated by dilution of SARS-CoV-2 spike specific Ab, e.g. CR3022 (expression plasmid set used for production in FreeStyle 293-F cells: CAT# NR-53260, BEI Resources; ready-made Ab: CAT# NR-52481, BEI Resources, RRID:AB_2936472), in non-reactive serum or plasma. • Negative control: serum or plasma drawn from healthy donors before 2019. Equipment Utilizing a plate washer minimizes variation in assay results and is the preferred method over manual washing of ELISA plates using a multichannel pipette. • Class II biological safety cabinet, Thermo Scientific, CAT# 51025411 • Eppendorf Research plus pipettes: ○ 30 – 300 μL, 12-channel, CAT# 3125000060 ○ 2 – 20 μL, 1-channel, CAT# 3123000039 ○ 20 – 200 μL, 1-channel, CAT# 3123000055 ○ 100 – 1,000 μL, 1-channel, CAT# 3123000063 • Plate washer HydroSpeed, Tecan, CAT# 30054550, RRID:SCR_023457 • Plate reader Spark, Tecan, CAT# 30086376, RRID:SCR_021897 Consumables • Pipette tips with filter ○ 10-20 μl, TipOne, CAT# S1120-3710 ○ 20-200 μL, Biosphere, CAT# 70.1189.215 ○ 100-1000 μl, TipOne, CAT# S1122-1730 • Single use reservoir, Integra, CAT# 4312 • Plates: ○ 96-well plates, polystyrene, transparent, U-bottom, Greiner Bio-One, CAT# 650101 ○ 96-well ELISA plates, polystyrene, transparent, F-bottom, MaxiSorp, Nunc, Thermo Scientific, CAT# 442404 • 50 mL tubes,
Techniques: Enzyme-linked Immunosorbent Assay, Software, Saline, Produced, Plasmid Preparation, Transfection, Sterility, Positive Control, Clinical Proteomics, Generated, Expressing, Negative Control, Transferring