software of origin, graph-pad prism for windows version 5.0 Search Results


90
MedCalc Software Ltd medcalc version 17.4.4
Medcalc Version 17.4.4, supplied by MedCalc Software Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/medcalc+9+0+1/pmc06156314-85-15-14
Average 90 stars, based on 1 article reviews
medcalc version 17.4.4 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
STATA Corporation graph pad prism1 2007 software
Graph Pad Prism1 2007 Software, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/STATA+5%2E0/pm21112824-95-8-15
Average 99 stars, based on 1 article reviews
graph pad prism1 2007 software - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
RStudio version 3.6.2
Version 3.6.2, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/rstudio+version+1+3+1093/pmc07573152-161-11-9
Average 90 stars, based on 1 article reviews
version 3.6.2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
SYSTAT tablecurve 2d
Tablecurve 2d, supplied by SYSTAT, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/TableCurve+2D+v5%2E0/pmc09105696-220-0-7
Average 95 stars, based on 1 article reviews
tablecurve 2d - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
MedCalc Software Ltd version 19.6
Version 19.6, supplied by MedCalc Software Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/version+19+1/pmc08447905-72-11-10
Average 90 stars, based on 1 article reviews
version 19.6 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Abbott Laboratories ld 50 values
Ld 50 Values, supplied by Abbott Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/50+ld+values/pmc12441774-83-30-24
Average 86 stars, based on 1 article reviews
ld 50 values - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Chemical Computing Group d 001810 10 50 software
D 001810 10 50 Software, supplied by Chemical Computing Group, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/environment+molecular+operating/pm42085183-230-59-87
Average 86 stars, based on 1 article reviews
d 001810 10 50 software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Becton Dickinson facs diva 5.1 software
Facs Diva 5.1 Software, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/facsdiva+software/pm33440150-234-176-189
Average 90 stars, based on 1 article reviews
facs diva 5.1 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
10X Genomics krec assay reverse 50 ctccaataagtcaccctttccttgt 30
Krec Assay Reverse 50 Ctccaataagtcaccctttccttgt 30, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/30+50+assay+ctccaataagtcaccctttccttgt+krec+reverse/pm34626548-177-176-202
Average 86 stars, based on 1 article reviews
krec assay reverse 50 ctccaataagtcaccctttccttgt 30 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Bio-Rad tungsten particles bio rad dii invitrogen 11520326 mitoplates s1 biolog 14105 tgx stain free fastcast acrylamide solutions bio rad 1610183
Tungsten Particles Bio Rad Dii Invitrogen 11520326 Mitoplates S1 Biolog 14105 Tgx Stain Free Fastcast Acrylamide Solutions Bio Rad 1610183, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/SFX+ACRYL+SOLN+10%25%2C50-GEL+KIT/pm39333440-216-24-26
Average 96 stars, based on 1 article reviews
tungsten particles bio rad dii invitrogen 11520326 mitoplates s1 biolog 14105 tgx stain free fastcast acrylamide solutions bio rad 1610183 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Greiner Bio easyseal plate sealer

Easyseal Plate Sealer, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/Tube+50+Ml+Pp+30%2F115+Mm+Conical+Bottom/pmc10877937-5-284-280
Average 96 stars, based on 1 article reviews
easyseal plate sealer - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Physiologic Instruments vcc mc-2 amplifiers

Vcc Mc 2 Amplifiers, supplied by Physiologic Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+of+origin%2C+graph-pad+prism+for+windows+version+5%2E0/voltage+clamp+amplifier+vcc+mc6/pm34610318-143-78-102
Average 90 stars, based on 1 article reviews
vcc mc-2 amplifiers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Journal: MethodsX

Article Title: An efficient ELISA protocol for measurement of SARS-CoV-2 spike-specific IgG in human plasma and serum samples

doi: 10.1016/j.mex.2024.102596

Figure Lengend Snippet:

Article Snippet: , Self-prepared buffers and solutions Stock solutions of PBSA and PBSA-S should be kept sterile and stored at 4 °C. • 0.1 M sodium hydrogen carbonate (pH 8.6) • 1 N sulfuric acid • PBS with 0.05 % Tween 20 (PBS-T5) • PBS with 5 % BSA (PBSA) • PBSA with 0.01 % Tween 20 (PBSA-T1) • PBSA with 20 % sheep serum (PBSA-S) Assay controls • Positive control: SARS-CoV-2 IgG high serum or plasma sample. If not available, a positive control can be generated by dilution of SARS-CoV-2 spike specific Ab, e.g. CR3022 (expression plasmid set used for production in FreeStyle 293-F cells: CAT# NR-53260, BEI Resources; ready-made Ab: CAT# NR-52481, BEI Resources, RRID:AB_2936472), in non-reactive serum or plasma. • Negative control: serum or plasma drawn from healthy donors before 2019. Equipment Utilizing a plate washer minimizes variation in assay results and is the preferred method over manual washing of ELISA plates using a multichannel pipette. • Class II biological safety cabinet, Thermo Scientific, CAT# 51025411 • Eppendorf Research plus pipettes: ○ 30 – 300 μL, 12-channel, CAT# 3125000060 ○ 2 – 20 μL, 1-channel, CAT# 3123000039 ○ 20 – 200 μL, 1-channel, CAT# 3123000055 ○ 100 – 1,000 μL, 1-channel, CAT# 3123000063 • Plate washer HydroSpeed, Tecan, CAT# 30054550, RRID:SCR_023457 • Plate reader Spark, Tecan, CAT# 30086376, RRID:SCR_021897 Consumables • Pipette tips with filter ○ 10-20 μl, TipOne, CAT# S1120-3710 ○ 20-200 μL, Biosphere, CAT# 70.1189.215 ○ 100-1000 μl, TipOne, CAT# S1122-1730 • Single use reservoir, Integra, CAT# 4312 • Plates: ○ 96-well plates, polystyrene, transparent, U-bottom, Greiner Bio-One, CAT# 650101 ○ 96-well ELISA plates, polystyrene, transparent, F-bottom, MaxiSorp, Nunc, Thermo Scientific, CAT# 442404 • 50 mL tubes, Greiner Bio-One, CAT# 227261 • EASYseal plate sealer, transparent, Grainer Bio-One, CAT# 676001 Software • SparkControl (version 3.1), Tecan, included with Plate washer • GraphPad Prism 9 (version 9.5.0), Dotmatics.

Techniques: Enzyme-linked Immunosorbent Assay, Software, Saline, Produced, Plasmid Preparation, Transfection, Sterility, Positive Control, Clinical Proteomics, Generated, Expressing, Negative Control, Transferring